Triple Helix
Mostrando 25-36 de 281 artigos, teses e dissertações.
-
25. Proton exchange and local stability in a DNA triple helix containing a G.TA triad
Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The
Oxford University Press.
-
26. Triple helix formation at distant sites: hybrid oligonucleotides containing a polymeric linker.
An oligonucleotide hybrid is described which possesses two triple helix forming oligonucleotides which have been connected by a flexible polymeric linker chain. As a prototype, binding of this class of oligonucleotide to duplex DNA has been studied using a segment of the HSV-1 D-glycoprotein promoter, which possesses a pair of 12bp target sites for stable tr
-
27. Stability of triple helices containing RNA and DNA strands: experimental and molecular modeling studies.
UV-absorption spectrophotometry and molecular modeling have been used to study the influence of the chemical nature of sugars (ribose or deoxyribose) on triple helix stability. For the Pyrimidine.purine* Pyrimidine motif, all eight combinations were tested with each of the three strands composed of either DNA or RNA. The chemical nature of sugars has a drama
-
28. Site-resolved stabilization of a DNA triple helix by magnesium ions
Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measure
Oxford University Press.
-
29. An important base triple anchors the substrate helix recognition surface within the Tetrahymena ribozyme active site
Key to understanding the structural biology of catalytic RNA is determining the underlying networks of interactions that stabilize RNA folding, substrate binding, and catalysis. Here we demonstrate the existence and functional importance of a Hoogsteen base triple (U300⋅A97-U277), which anchors the substrate helix recognition surface within the Tetrahymena
The National Academy of Sciences.
-
30. Inhibition of HIV-1 reverse transcription by triple-helix forming oligonucleotides with viral RNA.
Reverse transcription of retroviral RNA into double-stranded DNA is catalyzed by reverse transcriptase (RT). A highly conserved polypurine tract (PPT) on the viral RNA serves as primer for plus-strand DNA synthesis and is a possible target for triple-helix formation. Triple-helix formation during reverse transcription involves either single-stranded RNA or a
-
31. Folding defects in fibrillar collagens.
Fibrillar collagens have a long triple helix in which glycine is in every third position for more than 1000 amino acids. The three chains of these molecules are assembled with specificity into several different molecules that have tissue-specific distribution. Mutations that alter folding of either the carboxy-terminal globular peptides that direct chain ass
-
32. Rational design of a triple helix-specific intercalating ligand
DNA triple helices offer new perspectives toward oligonucleotide-directed gene regulation. However, the poor stability of some of these structures might limit their use under physiological conditions. Specific ligands can intercalate into DNA triple helices and stabilize them. Molecular modeling and thermal denaturation experiments suggest that benzo[f]pyrid
The National Academy of Sciences.
-
33. Polyamine-linked oligonucleotides for DNA triple helix formation.
The concept of antigene therapy of disease is based on the ability of an oligonucleotide (the therapeutic agent) to bind to double-stranded genomic DNA (the target associated with the disease). Examples are herein given of the linkage of a series of polyamines to a 21-mer homopyrimidine oligonucleotide. These conjugated 21-mers can each form a triple helix w
-
34. Inhibition of gene expression by triple helix-directed DNA cross-linking at specific sites.
Synthetic oligodeoxynucleotides represent promising tools for gene inhibition in live systems. Triple helix-forming oligonucleotides, which bind to double-stranded DNA, are of special interest since they are targeted to the gene itself rather than to its mRNA product, as in the antisense strategy. Triple helix-forming oligonucleotides can be coupled to DNA-m
-
35. Detection of covalent triplex within human cells.
Triple helix-forming oligonucleotides covalently linked to psoralen can be specifically cross-linked to both strands of DNA at the triplex-duplex junction following UV irradiation. We have previously shown that a 15mer psoralen-oligonucleotide conjugate forming a triple helix on the promoter of the alpha subunit gene of the interleukin-2 receptor inhibits tr
-
36. Sequence-specific labeling of superhelical DNA by triple helix formation and psoralen crosslinking.
Site-specific labeling of covalently closed circular DNA was achieved by using triple helix-forming oligonucleotides 10, 11 and 27 nt in length. The sequences consisted exclusively of pyrimidines (C and T) with a reactive psoralen at the 5'-end and a biotin at the 3'-end. The probes were directed to different target sites on the plasmids pUC18 (2686 bp), pUC