Single Cell Proteins
Mostrando 1-12 de 2048 artigos, teses e dissertações.
-
1. Proteomic research and diagnosis in bladder cancer: state of the art review
ABSTRACT Purpose: Proteomic biomarkers have been emerging as alternative methods to the gold standard procedures of cystoscopy and urine cytology in the diagnosis and surveillance of bladder cancer (BC). This review aims to update the state of the art of proteomics research and diagnosis in BC. Materials and Methods: We reviewed the current literature rela
Int. braz j urol.. Publicado em: 2021-06
-
2. Is it time to use hematopoietic stem cell transplantation for severe and refractory crohn's disease?
ABSTRACT COVID-19 (coronavirus disease 2019) is an infectious disease caused by the new coronavirus associated with severe acute respiratory syndrome 2 (SARS-CoV-2). Coronaviridae comprises a large family, of which at least seven members are known to cause respiratory diseases in humans. Coronaviruses have the ability to infect virtually all major groups of
Hematol., Transfus. Cell Ther.. Publicado em: 2020-06
-
3. Engineered scPDL1-DM1 drug conjugate with improved in vitro analysis to target PD-L1 positive cancer cells and intracellular trafficking studies in cancer therapy
Abstract Antibody-drug conjugates (ADC), precisely deliver a cytotoxic agent to antigen-expressing tumor cells by using specific binding strategies of antibodies. The ADC has shown the ability of potent bio-therapeutics development but indefinite stoichiometric linkage and full-length antibody penetration compromised the field of its advancement. Single chai
Genet. Mol. Biol.. Publicado em: 17/01/2020
-
4. Rhizosphere Bacterial Composition of the Sugar Beet Using SDS-PAGE Methodology
ABSTRACT The rhizosphere zone has been defined as the volume of soil directly influenced by the presence of living plant roots or soil compartment influenced by the root. During the growing season of 2014, the rhizobacteria of 23 sugar beet plants sampled from 12 sites in the west and north west of Iran were inventoried. Using a cultivation-dependent approac
Braz. arch. biol. technol.. Publicado em: 14/06/2018
-
5. Subcellular localisation of FLAG tagged enzymes of the dynamic protein S-palmitoylation cycle of Trypanosoma cruzi epimastigotes
Dynamic S-palmitoylation of proteins is the addition of palmitic acid by zDHHC palmitoyl transferases (PATs) and depalmitoylation by palmitoyl protein thioesterases (PPTs). A putative PAT (TcPAT1) has been previously identified in Trypanosoma cruzi, the etiological agent of Chagas disease. Here we analyse other 14 putative TcPATs and 2 PPTs in the parasite g
Mem. Inst. Oswaldo Cruz. Publicado em: 28/05/2018
-
6. Cultivation of Pichia pastoris carrying the scFv anti LDL (-) antibody fragment. Effect of preculture carbon source
Abstract Antibodies and antibody fragments are nowadays among the most important biotechnological products, and Pichia pastoris is one of the most important vectors to produce them as well as other recombinant proteins. The conditions to effectively cultivate a P. pastoris strain previously genetically modified to produce the single-chain variable fragment a
Braz. J. Microbiol.. Publicado em: 2017-07
-
7. Single-walled carbon nanotubes functionalized with sodium hyaluronate enhance bone mineralization
The aim of this study was to evaluate the effects of sodium hyaluronate (HY), single-walled carbon nanotubes (SWCNTs) and HY-functionalized SWCNTs (HY-SWCNTs) on the behavior of primary osteoblasts, as well as to investigate the deposition of inorganic crystals on titanium surfaces coated with these biocomposites. Primary osteoblasts were obtained from the c
Braz J Med Biol Res. Publicado em: 04/12/2015
-
8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014
-
9. p16 (INK4a) has clinicopathological and prognostic impact on oropharynx and larynx squamous cell carcinoma
CDKN2A encodes proteins such as p16 (INK4a), which negatively regulate the cell-cycle. Molecular genetic studies have revealed that deletions in CDKN2A occur frequently in cancer. Although p16 (INK4a) may be involved in tumor progression, the clinical impact and prognostic implications in head and neck squamous cell carcinoma (HNSCC) are controversial. The o
Braz J Med Biol Res. Publicado em: 2012-12
-
10. Protein turnover, amino acid requirements and recommendations for athletes and active populations
Skeletal muscle is the major deposit of protein molecules. As for any cell or tissue, total muscle protein reflects a dynamic turnover between net protein synthesis and degradation. Noninvasive and invasive techniques have been applied to determine amino acid catabolism and muscle protein building at rest, during exercise and during the recovery period after
Braz J Med Biol Res. Publicado em: 2012-10
-
11. Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D
Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements
Brazilian Journal of Medical and Biological Research. Publicado em: 2011-05
-
12. Mecanismos envolvidos com a sobrevivência de Xylella fastidiosa em condições de estresse e efeito de N-Acetil-L-Cisteína em seu biofilme / Mechanisms involved in Xylella fastidiosa survival under stress conditions and effect of N-Acetyl-L-Cysteine on its biofilm
Xylella fastidiosa is a Gram-negative bacterium that causes several diseases in different plant species, including citrus variegated chlorosis (CVC) in sweet orange (Citrus sinensis L. Osbeck), whose economic damage is of millions of dollars annually. The symptoms development has been associated with the blockage of xylem vessels caused by bacterial biofilm
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 15/06/2010