Gene Silencing
Mostrando 1-12 de 1059 artigos, teses e dissertações.
-
1. A germline-targeted genetic screen for xrn-2 suppressors identifies a novel gene C34C12.2 in Caenorhabditis elegans
Abstract XRN2 is an evolutionarily conserved 5’-to-3’ exoribonuclease, which degrades or trims various types of RNA in the nucleus. Although XRN-2 is essential for embryogenesis, larval development and reproduction in Caenorhabditis elegans, relevant molecular pathways remain unidentified. Here we create a germline-specific xrn-2 conditional mutant and p
Genetics and Molecular Biology. Publicado em: 2023
-
2. Gene Silencing Therapeutics in Cardiology: A Review Article
Abstract Therapeutics that inhibit enzymes, receptors, ion channels, and cotransporters have long been the mainstay of cardiovascular medicine. Now, oligonucleotide therapeutics offer a modern variation on this paradigm of protein inhibition. Rather than target a protein, however, small interfering ribonucleic acids and antisense oligonucleotides target the
International Journal of Cardiovascular Sciences. Publicado em: 2022
-
3. Long non-coding RNA HOTAIR induces the PI3K/AKT/mTOR signaling pathway in breast cancer cells
SUMMARY OBJECTIVE: The phosphoinositide 3-kinase/protein kinase AKT/mammalian target of rapamycin signaling pathway is essential for proper cellular metabolism and cell growth. However, aberrant activation of this pathway has been linked to the progression and metastasis of breast cancer. Recently, the role of long non-coding RNAs in interfering with the ce
Revista da Associação Médica Brasileira. Publicado em: 2022
-
4. Analysis of the Gene Expression and RNAi-Mediated Knockdown of Chitin Synthase from Leaf-Cutting Ant Atta sexdens
Chitin synthase (CHS) is the enzyme specifically associated with chitin synthesis, an important component of diverse organisms including insects. Two alternative spliced transcripts of the CHS gene (AsCHS-A1 and AsCHS-A2) were identified by quantitative reverse-transcription polymerase chain reaction (RT-qPCR) during the development of the leaf-cutting ant A
J. Braz. Chem. Soc.. Publicado em: 2020-10
-
5. Ca2+/Calmodulin-dependent kinase II delta B is essential for cardiomyocyte hypertrophy and complement gene expression after LPS and HSP60 stimulation in vitro
Inflammation plays an important role in the development of cardiovascular diseases (CVDs), suggesting that the immune system is a target of therapeutic interventions used for treating CVDs. This study evaluated mechanisms underlying inflammatory response and cardiomyocyte hypertrophy associated with bacterial lipopolysaccharide (LPS)- or heat shock protein 6
Braz J Med Biol Res. Publicado em: 15/07/2019
-
6. pGVG: a new Gateway-compatible vector for transformation of sugarcane and other monocot crops
Abstract The successful development of genetically engineered monocots using Agrobacterium-mediated transformation has created an increasing demand for compatible vectors. We have developed a new expression vector, pGVG, for efficient transformation and expression of different constructs for gene overexpression and silencing in sugarcane. The pCAMBIA2300 bin
Genet. Mol. Biol.. Publicado em: 11/06/2018
-
7. Knockout of p16INK4a promotes aggregative growth of dermal papilla cells
Summary Objective: Dermal papilla cells (DPCs) are located in the hair follicles and play an important role in hair growth. These cells have the ability to induce hair follicle formation when they display aggregative behavior. DPCs derived from the androgenetic alopecia (AGA) area undergo premature senescence in vitro, associated with p16INK4a expression. T
Rev. Assoc. Med. Bras.. Publicado em: 2017-10
-
8. New evidences on the regulation of SF-1 expression by POD1/TCF21 in adrenocortical tumor cells
OBJECTIVES: Transcription Factor 21 represses steroidogenic factor 1, a nuclear receptor required for gonadal development, sex determination and the regulation of adrenogonadal steroidogenesis. The aim of this study was to investigate whether silencing or overexpression of the gene Transcription Factor 21 could modulate the gene and protein expression of st
Clinics. Publicado em: 2017-06
-
9. PDK2 promotes chondrogenic differentiation of mesenchymal stem cells by upregulation of Sox6 and activation of JNK/MAPK/ERK pathway
This study was undertaken to clarify the role and mechanism of pyruvate dehydrogenase kinase isoform 2 (PDK2) in chondrogenic differentiation of mesenchymal stem cells (MSCs). MSCs were isolated from femurs and tibias of Sprague-Dawley rats, weighing 300-400 g (5 females and 5 males). Overexpression and knockdown of PDK2 were transfected into MSCs and then c
Braz J Med Biol Res. Publicado em: 16/02/2017
-
10. In Silico Identification of MicroRNAs with B/CYDV Gene Silencing Potential
ABSTRACT Computational investigation of a set of publicly available plant microRNAs revealed 19 barley- and other plants-encoded miRNAs and their near-complement reverse sequences (miRNA*) that have potential to bind all B/CYDV open reading frames (ORFs) except ORF0 and ORF6. These miRNAs/miRNAs*, their binding positions and targets are discussed in the cont
Braz. arch. biol. technol.. Publicado em: 01/12/2016
-
11. The Role of Apollon Gene Silencing on Viablity and Radiosensitivity of Cervical Cancer Hela Cells
Cervical cancer is the second common cause of cancer deaths in women worldwide. Radioresistancy of cancer is a principal cause of treatment impairing. Inhibitor of apoptosis proteins (IAPs) widely block apoptosis against apoptotic stimuli, including current chemo- and radiation therapies. Apollon, a membrane of IAP, can support cells against apoptosis and is
Braz. arch. biol. technol.. Publicado em: 06/05/2016
-
12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014