Gc Rich Sequence
Mostrando 1-12 de 332 artigos, teses e dissertações.
-
1. Brown Stink Bug Mortality by Seed Extracts of Tephrosia Vogelii Containing Deguelin and Tephrosin
ABSTRACT Extracts of the seeds of Tephrosia vogelii Hook. f. were studied in relation to its chemical composition and toxicity to the brown stink bug Euschistus heros (F.). The extracts were obtained in ethyl acetate and ethanol in the sequence according to the polar nature of the solvents. Extracts were sprayed in concentration of 1.0, 2.5, 5.0, 7.5 and 10%
Braz. arch. biol. technol.. Publicado em: 29/11/2018
-
2. Isolation and in silico characterization of cDNA encoding cyclophilin from etiolated Vigna mungo seedlings
A full-length cDNA clone encoding cyclophilin gene of 848 bp, including a 519 bp open reading frame, has been isolated from the cDNA library constructed from etiolated seedlings of Vigna mungo (GenBank FN668732). The cDNA sequence showed 97% identity with Vigna radiata cyclophilin mRNA. The sequence was GC rich and lacked introns. The open reading frame enco
Braz. J. Plant Physiol.. Publicado em: 2012
-
3. Territórios heterocromáticos em Triatoma infestans Klug e Panstrongylus megistus (Burmeister) : composição, identificação de marcadores epigenéticos e resposta a inibidores de deacetilases de histonas / Heterochromatic territories in Triatoma infestans Klug and Panstrongylus megistus (Burmeister) : composition, identification of epigenetic markers and response to histone deacetylase inhibitors
A cromatina pode existir em núcleos interfásicos em dois estados distintos: como eucromatina e como heterocromatina, podendo ser esta constitutiva ou facultativa. Em células somáticas do final da fase ninfal dos hemípteros reduviídeos Triatoma infestans e Panstrongylus megistus há núcleos grandes, poliploides, nos quais a heterocromatina apresenta-se
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 13/12/2011
-
4. Cloning, mapping and molecular characterization of porcine progesterone receptor membrane component 2 (PGRMC2) gene
Progesterone plays an important role in sow reproduction by stimulating classic genomic pathways via nuclear receptors and non-genomic pathways via membrane receptors such a progesterone receptor membrane component 2 (PGRMC2). In this work, we used radiation hybrid mapping to assign PGRMC2 to pig chromosome 8 and observed that this receptor has two transcrip
Genetics and Molecular Biology. Publicado em: 25/06/2010
-
5. Chromosomal organization and phylogenetic relationships in Hypochaeris species (Asteraceae) from Brazil
The association of cytogenetic and molecular techniques has contributed to the analysis of chromosome organization and phylogeny in plants. The fluorochrome GC-specific CMA3, fluorescent in situ hybridization (FISH) and RAPD (Random Amplified Polymorphic DNA) markers were used to investigate chromosome structure and genetic relationships in Hypochaeris (Aste
Publicado em: 2010
-
6. Chromosomal organization and phylogenetic relationships in Hypochaeris species (Asteraceae) from Brazil
The association of cytogenetic and molecular techniques has contributed to the analysis of chromosome organization and phylogeny in plants. The fluorochrome GC-specific CMA3, fluorescent in situ hybridization (FISH) and RAPD (Random Amplified Polymorphic DNA) markers were used to investigate chromosome structure and genetic relationships in Hypochaeris (Aste
Genetics and Molecular Biology. Publicado em: 2005-03
-
7. Contribuição citogenética à análise da biodiversidade em Astyanax fasciatus (Pisces, Characidae).
Astyanax fasciatus is characterized as a cytogenetically diverse species. Sympatric and syntopic occurrence of distinct cytotypes corroborates the hypothesis that A. fasciatus might represent a species complex sharing a common denomination. In this work, specimens from three collection sites along Mogi-Guaçu River, on Southeastern Brazil, were examined: (1)
Publicado em: 2005
-
8. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene
The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the
Brazilian Journal of Medical and Biological Research. Publicado em: 2004-12
-
9. Silencing Homologous RNA Recombination Hot Spots with GC-Rich Sequences in Brome Mosaic Virus
It has been observed that AU-rich sequences form homologous recombination hot spots in brome mosaic virus (BMV), a tripartite positive-stranded RNA virus of plants (P. D. Nagy and J. J. Bujarski, J. Virol. 71:3799–3810, 1997). To study the effect of GC-rich sequences on the recombination hot spots, we inserted 30-nucleotide-long GC-rich sequences downstrea
American Society for Microbiology.
-
10. Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.
The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S r
-
11. PCR Amplification with Primers Based on IS2404 and GC-Rich Repeated Sequence Reveals Polymorphism in Mycobacterium ulcerans
We describe a simple genotyping method for Mycobacterium ulcerans based on PCR amplification of genomic regions between IS2404 and a frequently repeated GC-rich sequence. Application of this method to a global collection produced 10 M. ulcerans genotypes corresponding to their geographic origin.
American Society for Microbiology.
-
12. Activation of the adenovirus major late promoter by transcription factors MAZ and Sp1.
Multiple binding sites for the transcription factors MAZ and Sp1 within the adenovirus type 5 major late promoter have been identified by DNase I protection studies. In the proximal region of the promoter, both MAZ and Sp1 interact with GC-rich sequences flanking the TATA box. Two MAZ binding sites are centered at -18 and -36 relative to the transcriptional