Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

AUTOR(ES)

Sor, F

RESUMO

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

Documentos Relacionados

• Suppressor of yeast mitochondrial ochre mutations that maps in or near the 15S ribosomal RNA gene of mtDNA.
• Site-specific AT-cluster insertions in the mitochondrial 15S rRNA gene of the yeast S. cerevisiae.
• Identification of two erythromycin resistance mutations in the mitochondrial gene coding for the large ribosomal RNA in yeast.
• The structure of the gene coding for the phosphorylated ribosomal protein S10 in yeast.
• Transcription of an artificial ribosomal RNA gene in yeast.