Cytokeratin
Mostrando 13-24 de 219 artigos, teses e dissertações.
-
13. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects
Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%), meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wo
J. Appl. Oral Sci.. Publicado em: 2017-04
-
14. Goat umbilical cord cells are permissive to small ruminant lentivirus infection in vitro
Abstract Small ruminant lentiviruses isolated from peripheral blood leukocytes and target organs can be propagated in vitro in fibroblasts derived from goat synovial membrane cells. These cells are obtained from tissues collected from embryos or fetuses and are necessary for the establishment of the fibroblast primary culture. A new alternative type of host
Braz. J. Microbiol.. Publicado em: 2017-03
-
15. Phenotype and cell proliferation activity of duct-like structures in human sublingual glands: a histological and immunohistochemical study
There are several age-related microscopic changes in the salivary glands, including the increase in the number of duct-like structures (DLS). However, the true origin and the phenotype of the DLS are not known. Objective To evaluate the phenotype and the cell proliferation index of the DLS of human sublingual glands. Material and Methods Sixty sublingual gla
J. Appl. Oral Sci.. Publicado em: 2015-06
-
16. The role of intratumoral lymphovascular density in distinguishing primary from secondary mucinous ovarian tumors
OBJECTIVE: Ovarian mucinous metastases commonly present as the first sign of the disease and are capable of simulating primary tumors. Our aim was to investigate the role of intratumoral lymphatic vascular density together with other surgical-pathological features in distinguishing primary from secondary mucinous ovarian tumors. METHODS: A total of 124 ca
Clinics. Publicado em: 2014-12
-
17. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014
-
18. Cell block technique as an additional tool in the diagnosis of ameloblastoma
The objective of this study was to evaluate the cytological content of ameloblastomas of the jaw. Nine cases of ameloblastoma were punctured, and the intralesional material was processed using the cell block technique. After centrifugation, the pellet obtained from the punctured material was fixed in formaldehyde and routinely processed to inclusion in paraf
Braz. oral res.. Publicado em: 26/08/2014
-
19. Giant multicystic cystadenoma of Cowper's gland: a case report
Main findings We report what to our knowledge is the first case of a giant multicystic cystadenoma of the Cowper's glands. An otherwise healthy 41-year-old man presented with acute urinary retention. Physical examination showed a perineal mass. Different imaging techniques demonstrated a multicystic tumor and en bloc excision was performed. Histological eva
Int. braz j urol.. Publicado em: 2013-09
-
20. Basal cytokeratin as a potential marker of low risk of invasion in ductal carcinoma in situ
OBJECTIVES: Biological markers that predict the development of invasive breast cancer are needed to improve personalized therapy for patients diagnosed with ductal carcinoma in situ. We investigated the role of basal cytokeratin 5/6 in the risk of invasion in breast ductal carcinoma in situ. METHODS: We constructed tissue microarrays using 236 ductal carc
Clinics. Publicado em: 2013-05
-
21. Immunohistochemical profile of high-grade ductal carcinoma in situ of the breast
OBJECTIVE: To determine the frequency of the immunohistochemical profiles of a series of high-grade ductal carcinoma in situ of the breast. METHODS: One hundred and twenty-one cases of high-grade ductal carcinoma in situ, pure or associated with invasive mammary carcinoma, were identified from 2003 to 2008 and examined with immunohistochemistry for estrog
Clinics. Publicado em: 2013-05
-
22. Orthokeratinized odontogenic cyst: critical appraisal of a distinct entity
The orthokeratinized odontogenic cyst (OOC) is a rare developmental jaw cyst. Recognition of OOC as a unique entity has long been due, yet its inexplicable radiographic presentation resembling dentigerous cyst, histological likeness to odontogenic keratocyst (OKC) and inconsistent cytokeratin expression profiles overlapping with both as well as with the epid
Braz. J. Oral Sci.. Publicado em: 2013-03
-
23. Painel imunoistoquímico para distinção entre tricoepitelioma e carcinoma basocelular desenvolvido utilizando a técnica do TMA / Diagnostic utility of immunohistochemical panel in distinguishing trichoepithelioma and basal cell carcinoma: evaluation using tissue microarray samples
Trichoepithelioma is a benign neoplasm that shares both clinical and histological features with basal cell carcinoma. It is important to distinguish these neoplasms because they have different clinical behavior and require proper therapeutic planning. Many studies have addressed the use of immunohistochemistry to improve the differential diagnosis of these t
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 24/04/2012
-
24. Marcadores tumorais bioquímicos e imunocitoquímicos em efusões neoplásicas caninas / Biochemical and immunocytochemical tumor markers in canine neoplastic effusions
The cavity effusions frequently occur in the clinical routine of dogs. In most cases the effusions are benign caused by circulatory system disorders. Neoplasms are common causes of effusions in dogs, however not always the tumor cells are found in cytopathologycal analysis. The dosage of tumor markers is an alternative to make the neoplastic effusion diagnos
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 2012