Adenoids
Mostrando 13-24 de 26 artigos, teses e dissertações.
-
13. HÆMORRHAGE FOLLOWING THE REMOVAL OF TONSILS AND ADENOIDS
-
14. Large tonsils and adenoids in small children with cor pulmonale.
-
15. Mitogenicity of Mycoplasma fermentans for human lymphocytes.
The in vitro stimulation response of human lymphocytes to Mycoplasma fermentans was examined. M. fermentans stimulated DNA synthesis in blood lymphocytes from all of 20 healthy subjects examined. Only one of these subjects had complement-fixing antibodies to M. fermentans. Lymphocytes from 21 of 22 adenoids and from 1 spleen were also stimulated to DNA synth
-
16. Growth of influenza A virus in primary, differentiated epithelial cells derived from adenoids.
Epithelial cells of adenoid origin were grown in tissue culture to examine viral replication in cells that are the primary target of many human pathogens. These cells remained highly differentiated, with subpopulations of cells which retained active ciliary motility and others which demonstrated specialized secretory functions. The epithelial cells were perm
-
17. Induction of compartmentalized B-cell responses in human tonsils.
The capacity of tonsillar and nasal mucosal lymphoid tissues to serve as induction sites of local and/or distant B-cell responses in humans has been examined. The frequencies of vaccine-specific antibody-secreting cells (ASC) in cell suspensions from palatine tonsils (PT) and adenoids were determined after local (intra-tonsillar [i.t.]) and regional (intrana
-
18. A review of investigations into adenotonsillectomy
Operations on the tonsils and adenoids are among the most commonly performed of all operations but present a wide range of problems when attempts are made to evaluate the results. This article reviews the findings of the major evaluative studies and discusses the general difficulties that confront them, particularly those that arise from failure to take into
-
19. Comparison of replication of adenovirus type 2 and type 4 in human lymphocyte cultures.
Adenovirus type 2 was capable of replicating in purified lymphocyte cultures from human adenoid specimens. Phytohemagglutinin stimulation enhanced the replication of virus. Viral titers of 103 to 104 50% tissue culture infective doses per ml were reached after 4 to 8 days. Only 1 to 3 per 106 cells were found to produce virus. In contrast, there was no evide
-
20. Structural and Immunological Characteristics of Chronically Inflamed Adenotonsillar Tissue in Childhood
Recurrent or chronic adenotonsillar infections mainly affect children and frequently involve otherwise healthy subjects. Therefore, having excluded systemic immunological deficiencies, this disease may be due to a local dysfunction of the epithelial structures at either the rhino or oropharyngeal level. The aim of the present investigation was to analyze str
American Society for Microbiology.
-
21. Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically
-
22. A comparison of the adherence of fimbriated and nonfimbriated Haemophilus influenzae type b to human adenoids in organ culture.
Adherence of fimbriated and nonfimbriated variants of a single strain of Haemophilus influenzae type b to organ cultures of human adenoidal tissue was measured by three assays, two of which were quantitative. In one assay, the adherence of radioactively labeled bacteria was measured; the numbers of CFU of bacteria per gram of adenoidal tissue were 16.0 +/- 6
-
23. Lymphoid organs function as major reservoirs for human immunodeficiency virus.
The total number of human immunodeficiency virus type 1 (HIV-1)-infected circulating CD4+ T lymphocytes is considered to be a reflection of the HIV burden at any given time during the course of HIV infection. However, the low frequency of HIV-infected circulating CD4+ T lymphocytes and the low level or absence of plasma viremia in the early stages of infecti
-
24. Penetration of cefprozil into tonsillar and adenoidal tissues.
Penetration of cefprozil into tonsillar and/or adenoidal tissues was investigated for patients undergoing tonsillectomy and/or adenoidectomy. A total of 29 patients ranging in age from 2 to 14 years participated in the study. The tonsils and/or the adenoids were removed at times ranging from 0.33 to 3.17 h after oral administration of a dose of either 7.5 or