Th1 Th2 Cells
Mostrando 25-36 de 1075 artigos, teses e dissertações.
-
25. Effect of substitution of corn for molasses in diet on growth performance, nutrient digestibility, blood characteristics, fecal noxious gas emission, and meat quality in finishing pigs
ABSTRACT The objective of this experiment was to evaluate the effect of molasses as a substitute for corn in diet on growth performance, nutrient digestibility, blood characteristics, fecal noxious gas emission, and meat quality in finishing pigs. A total of 120 [(Landrace × Yorkshire) × Duroc] pigs with an average initial body weight (BW) of 54.21±2.62 k
R. Bras. Zootec.. Publicado em: 2016-03
-
26. Correlation of serum IgE levels and clinical manifestations in patients with actinic prurigo
Abstract BACKGROUND: Actinic prurigo is an idiopathic photodermatosis, the pathophysiology of which has been hypothesized to involve subtype IV type b (Th2) hypersensitive response, whereby IL4, IL5, and IL13 are secreted and mediate the production of B cells, IgE, and IgG4. OBJECTIVES: To examine the association of serum IgE levels and the clinical severi
An. Bras. Dermatol.. Publicado em: 2016-02
-
27. [RETRACTED ARTICLE] Differential expression of CC chemokines (CCLs) and receptors (CCRs) by human T lymphocytes in response to different Aggregatibacter actinomycetemcomitans serotypes
ABSTRACT In Aggregatibacter actinomycetemcomitans, different serotypes have been described based on LPS antigenicity. Recently, our research group has reported a differential immunogenicity when T lymphocytes were stimulated with these different serotypes. In particular, it was demonstrated that the serotype b of A. actinomycetemcomitans has a stronger capac
J. Appl. Oral Sci.. Publicado em: 2015-12
-
28. Differential expression of CC chemokines (CCLs) and receptors (CCRs) by human T lymphocytes in response to different Aggregatibacter actinomycetemcomitans serotypes
In Aggregatibacter actinomycetemcomitans, different serotypes have been described based on LPS antigenicity. Recently, our research group has reported a differential immunogenicity when T lymphocytes were stimulated with these different serotypes. In particular, it was demonstrated that the serotype b of A. actinomycetemcomitans has a stronger capacity to tr
J. Appl. Oral Sci.. Publicado em: 2015-10
-
29. Comparative study of lymphocytes from individuals that were vaccinated and unvaccinated against the pandemic 2009-2011 H1N1 influenza virus in Southern Brazil
ABSTRACTINTRODUCTION:While no single factor is sufficient to guarantee the success of influenza vaccine programs, knowledge of the levels of immunity in local populations is critical. Here, we analyzed influenza immunity in a population from Southern Brazil, a region with weather conditions that are distinct from those in the rest of country, where influenza
Rev. Soc. Bras. Med. Trop.. Publicado em: 2015-10
-
30. Analysis of the healing process of the wounds occurring in rats using lasertherapy in association with hydrocolloid
PURPOSE: To evaluate wound healing in rats by using low-level laser therapy (LLLT) associated with hydrocolloid occlusive dressing . METHODS: Forty male, adult, Wistar rats were used, distributed into four groups: LG (received 2 J/cm² of laser therapy); HG (treated with hydrocolloid); LHG (treated with 2 J/cm² of laser therapy and hydrocolloid); and th
Acta Cir. Bras.. Publicado em: 2015-10
-
31. Rat visceral yolk sac cells: viability and expression of cell markers during maternal diabetes
The function of the visceral yolk sac (VYS) is critical for embryo organogenesis until final fetal development in rats, and can be affected by conditions such as diabetes. In view of the importance of diabetes during pregnancy for maternal and neonatal health, the objective of this study was to assess fetal weight, VYS cell markers, and viability in female W
Braz J Med Biol Res. Publicado em: 10/07/2015
-
32. Th2 cells and the IFN-γ R1 subunit in early and advanced experimental periodontitis in rats; an immunohistochemical study
Aim: To evaluate the involvement of Th2 cells in different periods of the active phase of experimental periodontal disease and expression of the R1 subunit of the receptor for IFN-γ during the early and advanced progression of the disease.
Methods: Experimental periodontitis was induced in 30 male Wista
Braz. J. Oral Sci.. Publicado em: 2015-06
-
33. Hepatoprotective effect of Ficus religiosa latex on cisplatin induced liver injury in Wistar rats
AbstractFicus religiosa L., Moraceae, is widely planted in the tropics. The chemical constituents of F. religiosa include tannin, saponin gluanol acetate, β-sitosterol, leucoanthocyanidin, and leucoanthocyanin. These are used for the treatment of pain, inflammation, impotence, menstrual disturbances, and urine related problems, and as uterine tonic. The pre
Rev. bras. farmacogn.. Publicado em: 2015-06
-
34. Prolonged viability of human organotypic skin explant in culture method (hOSEC)
Abstract BACKGROUND: Currently, the cosmetic industry is overwhelmed in keeping up with the safety assessment of the increasing number of new products entering the market. To meet such demand, research centers have explored alternative methods to animal testing and also the large number of volunteers necessary for preclinical and clinical tests. OBJECTIVES:
An. Bras. Dermatol.. Publicado em: 2015-06
-
35. Survival of Shiga toxin-producing Escherichia coli O157:H7 in Minas frescal cheese
Shiga toxin-producing Escherichia coli (STEC) O157:H7 strains (isolated by cattle’s faeces and a reference strain, EDL933), were inoculated into pasteurized milk (102 and 103 cells.mL–1) to prepare the Minas frescal cheese. As control was used uninfected milk. Physicochemical and microbiological analyses were performed to milk and elaborated cheese. The
Food Sci. Technol. Publicado em: 2015-03
-
36. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014