Interleukins
Mostrando 13-24 de 158 artigos, teses e dissertações.
-
13. Mineral supplementation stimulates the immune system and antioxidant responses of dairy cows and reduces somatic cell counts in milk
ABSTRACT The aim of this study was to evaluate whether the use of subcutaneous mineral supplementation would affect metabolic parameters, immunological response, milk quality and composition of dairy cows in the postpartum period. Twelve pregnant primiparous Holstein cows, were divided into two groups: six animals supplemented with the mineral complex (magne
An. Acad. Bras. Ciênc.. Publicado em: 2018-04
-
14. Intestinal parasitism among waste pickers in Mato Grosso do Sul, Midwest Brazil
ABSTRACT The purpose of this study was to estimate the prevalence of intestinal parasites in both cooperative-affiliated and independent waste pickers operating at the municipal sanitary landfill in Campo Grande, Mato Grosso do Sul, Brazil, and associate these findings with hemoglobin, eosinophils, vitamin A and C levels and interleukin 5 and 10 (IL-5 and IL
Rev. Inst. Med. trop. S. Paulo. Publicado em: 21/12/2017
-
15. Oxidative stress and immune system analysis after cycle ergometer use in critical patients
OBJECTIVE: The passive cycle ergometer aims to prevent hypotrophy and improve muscle strength, with a consequent reduction in hospitalization time in the intensive care unit and functional improvement. However, its effects on oxidative stress and immune system parameters remain unknown. The aim of this study is to analyze the effects of a passive cycle ergo
Clinics. Publicado em: 2017-03
-
16. Associated Clinical and Laboratory Markers of Donor on Allograft Function After Heart Transplant
Abstract Introduction: Primary graft dysfunction is a major cause of mortality after heart transplantation. Objective: To evaluate correlations between donor-related clinical/biochemical markers and the occurrence of primary graft dysfunction/clinical outcomes of recipients within 30 days of transplant. Methods: The prospective study involved 43 donor/rec
Braz. J. Cardiovasc. Surg.. Publicado em: 2016-04
-
17. STUDIES OF MOLECULAR CHANGES IN INTERVERTEBRAL DISC DEGENERATION IN ANIMAL MODEL
ABSTRACT Objective: To evaluate the structural and molecular changes in the extracellular matrix (ECM) during the process of intervertebral disc degeneration, using animal model. Methods: Wistar rats underwent intervertebral disc degeneration through 20-gauge needle puncture, and 360° rotation applied for 30 sec, representing the degenerated group, whil
Acta ortop. bras.. Publicado em: 2016-02
-
18. Wound healing treatment by high frequency ultrasound, microcurrent, and combined therapy modifies the immune response in rats
BACKGROUND: Therapeutic high-frequency ultrasound, microcurrent, and a combination of the two have been used as potential interventions in the soft tissue healing process, but little is known about their effect on the immune system. OBJECTIVE: To evaluate the effects of therapeutic high frequency ultrasound, microcurrent, and the combined therapy of the
Braz. J. Phys. Ther.. Publicado em: 19/01/2016
-
19. Effects of metoclopramide on the expression of metalloproteinases and interleukins in left colonic anastomoses. An experimental study
PURPOSE : To evaluate the effects of metoclopramide on metalloproteinases (MMP) and interleukins (IL) gene expression in colonic anastomoses in rats. METHODS : Eighty rats were divided into two groups for euthanasia on the 3rd or 7th postoperative day (POD), then into two subgroups for sepsis induction or not, and then into subgroups to receive either meto
Acta Cir. Bras.. Publicado em: 2015-11
-
20. Mechanisms of the beneficial effect of sevoflurane in liver ischemia/reperfusion injury
PURPOSE: To evaluate the underlying mechanisms by which sevoflurane protects the liver against ischemia/reperfusion injury evaluate the mechanism by which sevoflurane exerts this protective effect. METHODS: Twenty-six rats were subjected to partial ischemia/reperfusion injury for 1h: one group received no treatment, one group received sevoflurane, and s
Acta Cir. Bras.. Publicado em: 2015-11
-
21. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014
-
22. Relationship between deep venous thrombosis and inflammatory cytokines in postoperative patients with malignant abdominal tumors
Deep venous thrombosis (DVT) is a common surgical complication in cancer patients and evidence that inflammation plays a role in the occurrence of DVT is increasing. We studied a population of cancer patients with abdominal malignancies with the aim of investigating whether the levels of circulating inflammatory cytokines were associated with postoperative D
Braz J Med Biol Res. Publicado em: 22/08/2014
-
23. Effects of bromopride on expression of metalloproteinases and interleukins in left colonic anastomoses: an experimental study
Anastomotic dehiscence is the most severe complication of colorectal surgery. Metalloproteinases (MMPs) and interleukins (ILs) can be used to analyze the healing process of anastomosis. To evaluate the effects of bromopride on MMP and cytokine gene expression in left colonic anastomoses in rats with or without induced abdominal sepsis, 80 rats were divided i
Braz J Med Biol Res. Publicado em: 15/08/2014
-
24. Gene polymorphism of interleukin 1 and 8 in chronic gastritis patients infected with Helicobacter pylori
Background : Epidemiological investigations have indicated that Helicobacter pylori induces inflammation in the gastric mucosa regulated by several interleukins. The genes IL1B and IL8 are suggested as key factors in determining the risk of gastritis. The aim of this paper was to evaluate the association of gene polymorphism of interleukin-1 and inte
J. Venom. Anim. Toxins incl. Trop. Dis. Publicado em: 20/05/2014