Interferon Gamma
Mostrando 25-36 de 3448 artigos, teses e dissertações.
-
25. Interferon-gamma release assay versus tuberculin skin test for latent tuberculosis infection among HIV patients in Brazil
Abstract Setting Patients HIV+ attending in a reference clinic, Southern Brazil. Objective To compare the interferon-gamma-release assay (IGRA – QuantiFERON® TB Gold In-Tube) with the tuberculin skin test (TST – PPD-Rt 23) for latent tuberculosis infection (LTBI) in patients with HIV. Design Cohort study. Patients were simultaneously submitted to the
Braz J Infect Dis. Publicado em: 2016-02
-
26. Diagnosis of latent Mycobacterium tuberculosis infection: tuberculin test versus interferon-gamma release
Abstract: INTRODUCTION: The treatment of individuals with active tuberculosis (TB) and the identification and treatment of latent tuberculosis infection (LTBI) contacts are the two most important strategies for the control of TB. The objective of this study was compare the performance of tuberculin skin testing (TST) with QuantiFERON-TB Gold In TUBE(r) in
Rev. Soc. Bras. Med. Trop.. Publicado em: 2015-12
-
27. Assessment of the Potential Role of Silymarin Alone or in Combination with Vitamin E and/ or Curcumin on the Carbon Tetrachloride Induced Liver Injury in Rat
ABSTRACT The aim of this study was to investigate the effective role of silymarin either alone or in a combination with vitamin E and/or curcumin against the toxic impact of carbon tetrachloride (CCl4) induced liver injury The results revealed that administration of silymarin alone or in a combination with vitamin E and/or curcumin for 21 consecutive days, 2
Braz. arch. biol. technol.. Publicado em: 2015-12
-
28. Evaluation of short-interfering RNAs treatment in experimental rabies due to wild-type virus
ABSTRACTWe have evaluated the efficacy of short-interfering RNAs targeting the nucleoprotein gene and also the brain immune response in treated and non-treated infected mice. Mice were inoculated with wild-type virus, classified as dog (hv2) or vampire bat (hv3) variants and both groups were treated or leaved as controls. No difference was observed in the le
Braz J Infect Dis. Publicado em: 2015-10
-
29. Essential oil from Ageratum fastigiatum reduces expression of the pro-inflammatory cytokine tumor necrosis factor-alpha in peripheral blood leukocytes subjected to in vitro stimulation with phorbol myristate acetate
Abstract Ageratum fastigiatum (Gardner) R.M. King & H. Rob., a member of the Asteraceae family popularly known in Brazil as "matapasto", is indicated in folk medicine as anti-inflammatory and analgesic. Despite its popular use, little is known about its potential effect on the parameters involved in an inflammatory response. The objective of this study was t
Rev. bras. farmacogn.. Publicado em: 2015-04
-
30. Molecular characterization of the complement C1q, C2 and C4 genes in Brazilian patients with juvenile systemic lupus erythematosus
OBJECTIVE: To perform a molecular characterization of the C1q, C2 and C4 genes in patients with juvenile systemic lupus erythematosus. METHODS: Patient 1 (P1) had undetectable C1q, patient 2 (P2) and patient 3 (P3) had decreased C2 and patient 4 (P4) had decreased C4 levels. All exons and non-coding regions of the C1q and C2 genes were sequenced. Mononuclea
Clinics. Publicado em: 2015-03
-
31. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014
-
32. The preventive effects of natural adjuvants, G2 and G2F on tracheal responsiveness and serum IL-4 and IFN-γ (th1/th2 balance) in sensitized guinea pigs
OBJECTIVE:The effects of natural adjuvants on lung inflammation and tracheal responsiveness were examined in sensitized guinea pigs.METHODS:The responses of guinea pig tracheal chains and the serum levels of interleukin-4 and interferon-gamma were examined in control pigs and three other groups of guinea pigs: the sensitized group and two other sensitized gr
Clinics. Publicado em: 2014-07
-
33. Tuberculin skin test and interferon-gamma release assay values are associated with antimicrobial peptides expression in polymorphonuclear cells during latent tuberculous infection
It has been reported that patients with progressive tuberculosis (TB) express abundant amounts of the antimicrobial peptides (AMPs) cathelicidin (LL-37) and human neutrophil peptide-1 (HNP-1) in circulating cells, whereas latent TB infected donors showed no differences when compared with purified protein derivative (PPD) and QuantiFERON®-TB Gold (QFT)-healt
Mem. Inst. Oswaldo Cruz. Publicado em: 2014-06
-
34. Liver enzymes serum levels in patients with chronic kidney disease on hemodialysis: a comprehensive review
We reviewed the literature regarding the serum levels of the enzymes aspartate aminotransferase, alanine aminotransferase, and gamma-glutamyl transferase in patients with chronic kidney disease on hemodialysis with and without viral hepatitis. Original articles published up to January 2013 on adult patients with chronic kidney disease on hemodialysis were se
Clinics. Publicado em: 2014-04
-
35. Effects of single-dose atorvastatin on interleukin-6, interferon gamma, and myocardial no-reflow in a rabbit model of acute myocardial infarction and reperfusion
The mechanisms of statins relieving the no-reflow phenomenon and the effects of single-dose statins on it are not well known. This study sought to investigate the effects of inflammation on the no-reflow phenomenon in a rabbit model of acute myocardial infarction and reperfusion (AMI/R) and to evaluate the effects of single-dose atorvastatin on inflammation
Braz J Med Biol Res. Publicado em: 14/02/2014
-
36. Single nucleotide polymorphisms in the interferon gamma gene are associated with distinct types of retinochoroidal scar lesions presumably caused by Toxoplasma gondii infection
The association of single nucleotide polymorphisms (SNPs) in the interferon (IFN)-γ gene ( IFNG ) with different types of retinal scar lesions presumably caused by toxoplasmosis were investigated in a cross-sectional population-based genetic study. Ten SNPs were investigated and after Bonferroni correction, only the associations between SNPs rs2069718 and r
Mem. Inst. Oswaldo Cruz. Publicado em: 2014-02