Immune Related Proteins
Mostrando 1-12 de 295 artigos, teses e dissertações.
-
1. Corticotropin-releasing factor receptor signaling and modulation: implications for stress response and resilience
Abstract Introduction In addition to their role in regulation of the hypothalamic-pituitary-adrenal-axis, corticotropin-releasing factor (CRF) and its related peptides, the urocortins, are important mediators of physiological and pathophysiological processes of the central nervous, cardiovascular, gastrointestinal, immune, endocrine, reproductive, and skin
Trends Psychiatry Psychother.. Publicado em: 2020-06
-
2. COVID-19: laboratory diagnosis for clinicians. An updating article
ABSTRACT COVID-19 (coronavirus disease 2019) is an infectious disease caused by the new coronavirus associated with severe acute respiratory syndrome 2 (SARS-CoV-2). Coronaviridae comprises a large family, of which at least seven members are known to cause respiratory diseases in humans. Coronaviruses have the ability to infect virtually all major groups of
Sao Paulo Med. J.. Publicado em: 2020-06
-
3. Is it time to use hematopoietic stem cell transplantation for severe and refractory crohn's disease?
ABSTRACT COVID-19 (coronavirus disease 2019) is an infectious disease caused by the new coronavirus associated with severe acute respiratory syndrome 2 (SARS-CoV-2). Coronaviridae comprises a large family, of which at least seven members are known to cause respiratory diseases in humans. Coronaviruses have the ability to infect virtually all major groups of
Hematol., Transfus. Cell Ther.. Publicado em: 2020-06
-
4. Genome-wide identification, characterisation and expression profiling of the ubiquitin-proteasome genes in Biomphalaria glabrata
BACKGROUND Biomphalaria glabrata is the major species used for the study of schistosomiasis-related parasite-host relationships, and understanding its gene regulation may aid in this endeavor. The ubiquitin-proteasome system (UPS) performs post-translational regulation in order to maintain cellular protein homeostasis and is related to several mechanisms, i
Mem. Inst. Oswaldo Cruz. Publicado em: 03/06/2019
-
5. Antioxidant and immunomodulatory activities of Oviductus ranae in mice
Oviductus ranae (OR) is a traditional Chinese medicine, which was first recorded in the Compendium of Materia Medica in the Ming Dynasty. OR contains high amounts of proteins and elicits therapeutic effects on neurasthenia, insomnia, and respiratory symptoms, which are related to oxidative stress and immunodeficiency. This study aimed to obtain the potential
Braz. J. Pharm. Sci.. Publicado em: 08/04/2019
-
6. Progranulin concentration in relation to bone mineral density among obese individuals
ABSTRACT Objective Adipose tissue, particularly visceral adipose tissue, secretes a variety of cytokines, among which progranulin is a glycoprotein related to the immune system. Along with other secreted proteins, progranulin may be associated with bone mineral density. The aim of this study was to find out whether there are associations between the progran
Arch. Endocrinol. Metab.. Publicado em: 05/04/2018
-
7. Immunoproteomics of Plasmodium falciparum-infected red blood cell membrane fractions
BACKGROUND The surface of infected red blood cells (iRBCs) has been widely investigated because of the molecular complexity and pathogenesis mechanisms involved. Asymptomatic individuals are important in the field because they can perpetuate transmission as natural reservoirs and present a challenge for diagnosing malaria because of their low levels of circ
Mem. Inst. Oswaldo Cruz. Publicado em: 2017-12
-
8. Skin barrier in atopic dermatitis: beyond filaggrin
Abstract: Atopic dermatitis is a chronic inflammatory skin disease with a complex pathogenesis, where changes in skin barrier and imbalance of the immune system are relevant factors. The skin forms a mechanic and immune barrier, regulating water loss from the internal to the external environment, and protecting the individual from external aggressions, such
An. Bras. Dermatol.. Publicado em: 2016-08
-
9. Recent updates and perspectives on approaches for the development of vaccines against visceral leishmaniasis
Abstract: Visceral leishmaniasis (VL) is one of the most important tropical diseases worldwide. Although chemotherapy has been widely used to treat this disease, problems related to the development of parasite resistance and side effects associated with the compounds used have been noted. Hence, alternative approaches for VL control are desirable. Some metho
Rev. Soc. Bras. Med. Trop.. Publicado em: 2016-08
-
10. Reaching for the Holy Grail: insights from infection/cure models on the prospects for vaccines for Trypanosoma cruzi infection
Prevention of Trypanosoma cruzi infection in mammals likely depends on either prevention of the invading trypomastigotes from infecting host cells or the rapid recognition and killing of the newly infected cells by T. cruzi-specific T cells. We show here that multiple rounds of infection and cure (by drug therapy) fails to protect mice from reinfection, desp
Mem. Inst. Oswaldo Cruz. Publicado em: 28/04/2015
-
11. Differential expression of immunologic proteins in gingiva after socket preservation in mini pigs
During healing following tooth extraction, inflammation and the immune response within the extraction socket are related to bone resorption. Objective : We sought to identify how the alloplastic material used for socket preservation affects the immune responses and osteoclastic activity within extraction sockets. Material and Methods : Using a porcine model,
J. Appl. Oral Sci.. Publicado em: 2015-04
-
12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014