Euglena
Mostrando 25-36 de 259 artigos, teses e dissertações.
-
25. Studies on Chloroplast Development and Replication in Euglena: III. A Study of the Site of Synthesis of Alkaline Deoxyribonuclease Induced during Chloroplast Development in Euglena gracilis1
During chloroplast development in Euglena, the activity of a specific DNase, Euglena alkaline DNase, increases in a manner similar to that of chlorophyll synthesis, but without the lag customarily associated with the early hours of chlorophyll synthesis. The increase in Euglena alkaline DNase activity is not inhibited by chloramphenicol or by streptomycin, b
-
26. Effect of antimicrobial agents on the Euglena method of serum vitamin B12 assay
Antimicrobial agents in the serum may affect the results of the Euglena method of serum vitamin B12 assay. Sulphonamides suppress the growth of Euglena in concentrations attainable in the serum during treatment; streptomycin, chlortetracycline, erythromycin, kanamycin, and nitrofurantoin bleach Euglena but only when present in concentrations far exceeding th
-
27. Evidence for the late origin of introns in chloroplast genes from an evolutionary analysis of the genus Euglena.
The origin of present day introns is a subject of spirited debate. Any intron evolution theory must account for not only nuclear spliceosomal introns but also their antecedents. The evolution of group II introns is fundamental to this debate, since group II introns are the proposed progenitors of nuclear spliceosomal introns and are found in ancient genes fr
-
28. The gene for the large subunit of ribulose-1,5-bisphosphate carboxylase in Euglena gracilis chloroplast DNA: location, polarity, cloning, and evidence for an intervening sequence.
The gene for the large subunit (LS) of ribulose-1,5,-bisphosphate carboxylase of Euglena gracilis Z chloroplast DNA has been mapped by heterologous hybridization with DNA restriction fragments containing internal sequences from the Zea mays and Chlamydomonas reinhardii LS genes. The Euglena LS gene which has the same polarity as the Euglena rRNA genes has be
-
29. Ribulose Diphosphate Carboxylase Synthesis in Euglena: III. Serological Relationships of the Intact Enzyme and its Subunits 1
Ribulose 1,5-diphosphate carboxylase was isolated from Euglena gracilis Klebs strain Z Pringsheim, Chlorella fusca var. vacuolata, and Chlamydobotrys stellata, and the subunits from each enzyme were separated and purified by gel filtration on Sephadex G-200 in the presence of sodium dodecyl sulfate. Rabbit antibody was elicited against purified Euglena ribul
-
30. Preparation of Chloroplasts from Euglena Highly Active in Protein Synthesis 1
Chloroplasts can be obtained by gentle lysis or mild shear of spheroplasts of vitamin B12-deficient Euglena gracilis and then purified by isopycnic sedimentation on gradients of Ludox AM or Percoll. The chloroplasts appear compact and highly refractile by phase contrast or Hoffmann contrast microscopy. Upon incubation with [3H]leucine or [35S]methionine, the
-
31. Peroxidative Activity in Euglena gracilis1
Cell-free homogenates of Euglena gracilis contain very low levels of catalase activity as compared to higher plants and some other algae. Purified Euglena cytochrome c acts catalytically as a peroxidase. The observed catalytic activity of cytochrome c in extracts from heterotrophically grown cells was more than enough to account for the observed rates of hyd
-
32. Expression and subcellular location of the tetrapyrrole synthesis enzyme porphobilinogen deaminase in light-grown Euglena gracilis and three nonchlorophyllous cell lines.
The expression and subcellular location of porphobilinogen deaminase (PBGD, also known as hydroxymethylbilane synthase; EC 4.3.1.8), one of the early enzymes of porphyrin synthesis, was investigated in light-grown Euglena and in three cell lines that do not contain chlorophyll: dark-grown Euglena, a streptomycin-bleached mutant, and Astasia longa. In wild-ty
-
33. Extrachromosomal circular nuclear rDNA in Euglena gracilis.
The presence of extrachromosomal nuclear ribosomal DNA (rDNA) in the unicellular alga Euglena gracilis has been established. This rDNA is circular. Each circle is 3.8 micron long and contains one rDNA unit. Oligomers are rare. Extrachromosomal rDNA is present in large amounts during the exponential phase of growth and appears less abundant during the station
-
34. A Role for Zinc in the Structural Integrity of the Cytoplasmic Ribosomes of Euglena gacilis12
Zinc deficiency in dark-grown Euglena gracilis Klebs, Z strain Pringsheim, results in the disappearance of cytoplasmic ribosomes. In contrast, ribosomes in zinc-sufficient Euglena are conserved, do not undergo turnover, and can be demonstrated at any stage of growth. The zinc content of ribosomes from zinc-deficient Euglena just prior to ribosomal disappeara
-
35. Comparative base compositions of chloroplast and cytoplasmic tRNAPhe's from Euglena gracilis.
The nucleoside compositions of chloroplast and cytoplasmic tRNAPhe's from Euglena gracilis have been determined. The modified nucleoside compositions of these two tRNAs indicate that tRNAPheChl is more similar to procaryotic (E. coli) tRNAPhe than to either the Euglena cytoplasmic tRNAPhe or other eucaryotic cytoplasmic tRNAPhe's.
-
36. The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.
The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for