The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

AUTOR(ES)

Takaiwa, F

RESUMO

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

Documentos Relacionados

• The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.
• The nucleotide sequence of the 4.5S and 5S rRNA genes and flanking regions from Spirodela oligorhiza chloroplasts.
• Nucleotide sequence of the spinach chloroplast 4.5S ribosomal RNA gene and of its 5' flanking region including the 3' end of the 23S rRNA gene.
• Sequence and methylation of 5.8S rRNA in fern, Osmunda regalis.
• The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.