The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

AUTOR(ES)

Hori, H

RESUMO

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

Documentos Relacionados

• The nucleotide sequence of ribosomal 5S RNA from lettuce seeds.
• Nucleotide sequence of 5S ribosomal RNA from Rhodococcus erythropolis.
• The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.
• Nucleotide sequence of 5S ribosomal RNA of Rhodococcus fascians.
• The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.